Review

cgas crispr cas9 knockout cgas crispr cas9 plasmid (Santa Cruz Biotechnology)

Santa Cruz Biotechnology is a verified supplier

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Santa Cruz Biotechnology cgas crispr cas9 knockout cgas crispr cas9 plasmid
Cgas Crispr Cas9 Knockout Cgas Crispr Cas9 Plasmid, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 92/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/knockout+plasmids/cGAS+CRISPR%2FCas9+KO+Plasmid/pm41865031-456-13-20
Average 92 stars, based on 3 article reviews

cgas crispr cas9 knockout cgas crispr cas9 plasmid - by Bioz Stars, 2026-09

92/100 stars

Images

CRISPR:

Article Title: Y RNAs are conserved endogenous RIG-I ligands across RNA virus infection and are targeted by HIV-1.
Article Snippet: .. METHOD DETAILS Generation of CRISPR-edited cell lines 293T knock out cell lines were generated by cotransfection (lipofectamine 2000, Invitrogen) of CRISPR– Cas9-expressing knockout plasmids (MAVS: sc-400769-ko-2, RIG-I: sc-400812, both Santa Cruz) and Homology Directed Repair plasmids containing puromycin resistance gene (MAVS: sc-400769-HDR-2, RIGI: sc-400812-HDR, both Santa Cruz). ..

Article Title: IRE1α overexpression in malignant cells limits tumor progression by inducing an anti-cancer immune response
Article Snippet: .. For the generation of stable CT26 cells with invalidated IRE1α, cells were transfected with 3 μg of CRISPR-Cas9-expressing knockout plasmids (control, sc-418922 and IRE1α, sc-429758 from Santa Cruz) using the jetPEI DNA transfection reagent (PolyPlus Transfection, #POL101-10 N) as described by the manufacturer. ..

Article Title: Y RNAs are conserved endogenous RIG-I ligands across RNA virus infection and are targeted by HIV-1.
Article Snippet: .. 72 h after transfection cells were treated with puromycin (Invivogen, 1 mg/mL) for 1 week 293 and 2934x4 knock-out clones were generated by transfection (lipofectamine 2000, Invitrogen) of CRISPR–Cas9-expressing knockout plasmids (MAVS, sc-400769-ko-2 and control, sc-418922, both Santa Cruz). .. ST-RIG-I and ST-CH DUSP11 knock-out cells were generated by transfection (lipofectamine 2000) of CRISPR–Cas9-expressing knockout plasmids (DUSP11, sc-408162; control, sc-418922, both Santa Cruz).

Article Title: Y RNAs are conserved endogenous RIG-I ligands across RNA virus infection and are targeted by HIV-1.
Article Snippet: 72 h after transfection cells were treated with puromycin (Invivogen, 1 mg/mL) for 1 week 293 and 2934x4 knock-out clones were generated by transfection (lipofectamine 2000, Invitrogen) of CRISPR–Cas9-expressing knockout plasmids (MAVS, sc-400769-ko-2 and control, sc-418922, both Santa Cruz). .. ST-RIG-I and ST-CH DUSP11 knock-out cells were generated by transfection (lipofectamine 2000) of CRISPR–Cas9-expressing knockout plasmids (DUSP11, sc-408162; control, sc-418922, both Santa Cruz). .. 72 h after transfection cells were treated with puromycin (Invivogen, 1 mg/mL) for 1 week.

Article Title: IRE1α overexpression in malignant cells limits tumor progression by inducing an anti-cancer immune response
Article Snippet: .. For the generation of stable CT26 cells with invalidated IRE1α, cells were transfected with 3 μg of CRISPR-Cas9expressing knockout plasmids (control, sc-418922 and IRE1α, sc-429758 from Santa Cruz) using the jetPEI DNA transfection reagent (PolyPlus Transfection, #POL101-10 N) as described by the manufacturer. ..

Article Title: Y RNAs are conserved endogenous RIG-I ligands across RNA virus infection and are targeted by HIV-1
Article Snippet: .. 293T knock out cell lines were generated by cotransfection (lipofectamine 2000, Invitrogen) of CRISPR–Cas9-expressing knockout plasmids (MAVS: sc-400769-ko-2, RIG-I: sc-400812, both Santa Cruz) and Homology Directed Repair plasmids containing puromycin resistance gene (MAVS: sc-400769-HDR-2, RIG-I: sc-400812-HDR, both Santa Cruz). ..

Knock-Out:

Article Title: SARS-CoV-2 Accessory Protein Orf7b Induces Lung Injury via c-Myc Mediated Apoptosis and Ferroptosis.
Article Snippet: .. The transfection-ready knockout plasmids obtained from Santa Cruz Biotechnologies, Inc., Dallas TX, USA. (CAT# sc-400001-KO-2 and sc-400001-HDR-2) were used for the knockout studies. ..

Article Title: SARS-CoV-2 Accessory Protein Orf7b Induces Lung Injury via c-Myc Mediated Apoptosis and Ferroptosis
Article Snippet: .. The transfection-ready knockout plasmids obtained from Santa Cruz Biotechnologies, Inc., Dallas TX, USA. (CAT# sc-400001-KO-2 and sc-400001-HDR-2) were used for the knockout studies. ..

Article Title: IRE1α overexpression in malignant cells limits tumor progression by inducing an anti-cancer immune response
Article Snippet: .. For the generation of stable CT26 cells with invalidated IRE1α, cells were transfected with 3 μg of CRISPR-Cas9expressing knockout plasmids (control, sc-418922 and IRE1α, sc-429758 from Santa Cruz) using the jetPEI DNA transfection reagent (PolyPlus Transfection, #POL101-10 N) as described by the manufacturer. ..

Generated:

Cotransfection:

Transfection:

Article Title: IRE1α overexpression in malignant cells limits tumor progression by inducing an anti-cancer immune response
Article Snippet: .. For the generation of stable CT26 cells with invalidated IRE1α, cells were transfected with 3 μg of CRISPR-Cas9expressing knockout plasmids (control, sc-418922 and IRE1α, sc-429758 from Santa Cruz) using the jetPEI DNA transfection reagent (PolyPlus Transfection, #POL101-10 N) as described by the manufacturer. ..

Control:

Article Title: IRE1α overexpression in malignant cells limits tumor progression by inducing an anti-cancer immune response
Article Snippet: .. For the generation of stable CT26 cells with invalidated IRE1α, cells were transfected with 3 μg of CRISPR-Cas9expressing knockout plasmids (control, sc-418922 and IRE1α, sc-429758 from Santa Cruz) using the jetPEI DNA transfection reagent (PolyPlus Transfection, #POL101-10 N) as described by the manufacturer. ..

Clone Assay:

Image Search Results

( a ) Schematic view of ex vivo CRISPR/Cas9 screening in mouse primary CD8 + T-cells. ( b ) Volcano plot showing results of ex vivo CRISPR/Cas9 genome-wide screenings. The screenings were repeated independently once. The p-values were calculated using the α-robust rank aggregation (α-RRA) algorithm in MAGeCK. ( c ) Verification of candidate genes by individual single gRNAs. The relative expression levels of surface PD-1 protein and PD-1 mRNA were measured by FACS as mean fluorescent intensity (MFI) and RT-qPCR, respectively. The verification assays were biologically replicated twice. ( d ) GSEA of significantly enriched KEGG pathways in genome-wide screening. The enrichment score (ES) and statistical significance were calculated using the clusterProfiler (version 3.12.0) R package.

Journal: eLife

Article Title: Ex vivo and in vivo CRISPR/Cas9 screenings identify the roles of protein N-glycosylation in regulating T-cell activation and functions

doi: 10.7554/eLife.108724

Figure Lengend Snippet: ( a ) Schematic view of ex vivo CRISPR/Cas9 screening in mouse primary CD8 + T-cells. ( b ) Volcano plot showing results of ex vivo CRISPR/Cas9 genome-wide screenings. The screenings were repeated independently once. The p-values were calculated using the α-robust rank aggregation (α-RRA) algorithm in MAGeCK. ( c ) Verification of candidate genes by individual single gRNAs. The relative expression levels of surface PD-1 protein and PD-1 mRNA were measured by FACS as mean fluorescent intensity (MFI) and RT-qPCR, respectively. The verification assays were biologically replicated twice. ( d ) GSEA of significantly enriched KEGG pathways in genome-wide screening. The enrichment score (ES) and statistical significance were calculated using the clusterProfiler (version 3.12.0) R package.

Article Snippet: A whole-genome CRISPR knockout gRNA library (1000000096) was purchased from Addgene.

Techniques: Ex Vivo, CRISPR, Genome Wide, Expressing, Quantitative RT-PCR

( a ) Schematic view of in vivo CRISPR/Cas9 screening in mouse primary CD8 + T-cells. ( b ) Volcano plot showing results of ex vivo CRISPR/Cas9 screening. The screenings were repeated independently once. The p-values were calculated using the α-RRA algorithm in MAGeCK. ( c ) Volcano plot showing results of in vivo CRISPR/Cas9 screenings. The screenings were repeated independently once. The p-values were calculated using the α-RRA algorithm in MAGeCK.

Journal: eLife

Article Title: Ex vivo and in vivo CRISPR/Cas9 screenings identify the roles of protein N-glycosylation in regulating T-cell activation and functions

doi: 10.7554/eLife.108724

Figure Lengend Snippet: ( a ) Schematic view of in vivo CRISPR/Cas9 screening in mouse primary CD8 + T-cells. ( b ) Volcano plot showing results of ex vivo CRISPR/Cas9 screening. The screenings were repeated independently once. The p-values were calculated using the α-RRA algorithm in MAGeCK. ( c ) Volcano plot showing results of in vivo CRISPR/Cas9 screenings. The screenings were repeated independently once. The p-values were calculated using the α-RRA algorithm in MAGeCK.

Article Snippet: A whole-genome CRISPR knockout gRNA library (1000000096) was purchased from Addgene.

Techniques: In Vivo, CRISPR, Ex Vivo

( a ) CRISPR/Cas9 knockout of B4galt1 (sgB4galt1) (sg2) in CD8 + T-cells increases expression of PD-1 before and after co-culture with B16F10-OVA cells. The MFIs of PD-1 were measured by FACS (n=6). The relative mRNA levels of PD-1 were measured by quantitative RT-qPCR (n=6). The p-values were calculated using a two-tailed Student’s t -test. ( b ) The effect of B4galt1 knockout on PD-1 surface expression could be rescued by overexpression of either long- or short-isoform B4galt1 (n=3). The p-values were calculated using a two-tailed Student’s t -test. ( c ) CRISPR/Cas9 knockout of B4galt1 in CD8 + T-cells increases expression of TNFα and IFNγ after co-culture with B16F10-OVA cells. The relative mRNA levels were measured by quantitative RT-qPCR (n=3). The secreted TNFα and IFNγ in medium were measured by ELISA (n=6). The p-values were calculated using a two-tailed Student’s t -test. ( d ) CRISPR/Cas9 knockout of B4galt1 in OT-I CD8 + T-cells increases in vitro specific killing activities on B16F10-OVA cells (n=3). The p-values were calculated using a two-tailed Student’s t -test. ( e ) Schematic view of B4GALT1 knockdown in human NY-ESO-1 TCR-T-cells. ( f ) Knockdown of B4GALT1 in human NY-ESO-1 TCR-T-cells by shRNA increases in vitro killing activities on A375 cells (n=5). The p-values were calculated using a two-tailed Student’s t -test. ( g ) Knockdown of B4GALT1 in human NY-ESO-1 TCR-T-cells increases expression of TNFα and IFNγ after co-culture with A375 cells. The secreted TNFα and IFNγ in medium were measured by ELISA (n=3). The p-values were calculated using a two-tailed Student’s t -test. ( h ) Heatmap demonstrating differentially expressed genes (DEGs) between B4galt1 knockout and control mouse OT-I CD8 + T-cells after co-culture. The genes in TCR signaling pathway are labeled on the left side. ( i ) Volcano plot showing upregulated and downregulated genes (p-value <0.01) in B4galt1 knockout mouse OT-I CD8 + T-cells after co-culture. The genes in TCR signaling pathway are labeled with dark blue and dark red. Top genes and some genes in TCR signaling pathway are annotated. The p-value was calculated using the Wald test, and p.adjust was calculated using Benjamini–Hochberg with the R package DESeq2 (version 1.22.2). ( j ) Bar graph showing KEGG pathways significantly changed in B4galt1 knockout mouse OT-I CD8 + T-cells after co-culture. The p-value was calculated using the clusterProfiler (version 3.12.0) R package. All of these functional effects were biologically replicated at least twice. Data are shown as the mean ± SEM. *p<0.05; **p<0.01; ***p<0.001.

Journal: eLife

Article Title: Ex vivo and in vivo CRISPR/Cas9 screenings identify the roles of protein N-glycosylation in regulating T-cell activation and functions

doi: 10.7554/eLife.108724

Figure Lengend Snippet: ( a ) CRISPR/Cas9 knockout of B4galt1 (sgB4galt1) (sg2) in CD8 + T-cells increases expression of PD-1 before and after co-culture with B16F10-OVA cells. The MFIs of PD-1 were measured by FACS (n=6). The relative mRNA levels of PD-1 were measured by quantitative RT-qPCR (n=6). The p-values were calculated using a two-tailed Student’s t -test. ( b ) The effect of B4galt1 knockout on PD-1 surface expression could be rescued by overexpression of either long- or short-isoform B4galt1 (n=3). The p-values were calculated using a two-tailed Student’s t -test. ( c ) CRISPR/Cas9 knockout of B4galt1 in CD8 + T-cells increases expression of TNFα and IFNγ after co-culture with B16F10-OVA cells. The relative mRNA levels were measured by quantitative RT-qPCR (n=3). The secreted TNFα and IFNγ in medium were measured by ELISA (n=6). The p-values were calculated using a two-tailed Student’s t -test. ( d ) CRISPR/Cas9 knockout of B4galt1 in OT-I CD8 + T-cells increases in vitro specific killing activities on B16F10-OVA cells (n=3). The p-values were calculated using a two-tailed Student’s t -test. ( e ) Schematic view of B4GALT1 knockdown in human NY-ESO-1 TCR-T-cells. ( f ) Knockdown of B4GALT1 in human NY-ESO-1 TCR-T-cells by shRNA increases in vitro killing activities on A375 cells (n=5). The p-values were calculated using a two-tailed Student’s t -test. ( g ) Knockdown of B4GALT1 in human NY-ESO-1 TCR-T-cells increases expression of TNFα and IFNγ after co-culture with A375 cells. The secreted TNFα and IFNγ in medium were measured by ELISA (n=3). The p-values were calculated using a two-tailed Student’s t -test. ( h ) Heatmap demonstrating differentially expressed genes (DEGs) between B4galt1 knockout and control mouse OT-I CD8 + T-cells after co-culture. The genes in TCR signaling pathway are labeled on the left side. ( i ) Volcano plot showing upregulated and downregulated genes (p-value <0.01) in B4galt1 knockout mouse OT-I CD8 + T-cells after co-culture. The genes in TCR signaling pathway are labeled with dark blue and dark red. Top genes and some genes in TCR signaling pathway are annotated. The p-value was calculated using the Wald test, and p.adjust was calculated using Benjamini–Hochberg with the R package DESeq2 (version 1.22.2). ( j ) Bar graph showing KEGG pathways significantly changed in B4galt1 knockout mouse OT-I CD8 + T-cells after co-culture. The p-value was calculated using the clusterProfiler (version 3.12.0) R package. All of these functional effects were biologically replicated at least twice. Data are shown as the mean ± SEM. *p<0.05; **p<0.01; ***p<0.001.

Article Snippet: A whole-genome CRISPR knockout gRNA library (1000000096) was purchased from Addgene.

Techniques: CRISPR, Knock-Out, Expressing, Co-Culture Assay, Quantitative RT-PCR, Two Tailed Test, Over Expression, Enzyme-linked Immunosorbent Assay, In Vitro, Knockdown, shRNA, Control, Labeling, Functional Assay

CRISPR/Cas9 knockout of B4GALT1 in hCD19-CAR-T-cells does not affect in vitro killing of Nalm6 target cells (n=3). The killing assays were biologically replicated three times. Data are shown as the mean ± SEM. NS, not significant.

Journal: eLife

Article Title: Ex vivo and in vivo CRISPR/Cas9 screenings identify the roles of protein N-glycosylation in regulating T-cell activation and functions

doi: 10.7554/eLife.108724

Figure Lengend Snippet: CRISPR/Cas9 knockout of B4GALT1 in hCD19-CAR-T-cells does not affect in vitro killing of Nalm6 target cells (n=3). The killing assays were biologically replicated three times. Data are shown as the mean ± SEM. NS, not significant.

Article Snippet: A whole-genome CRISPR knockout gRNA library (1000000096) was purchased from Addgene.

Techniques: CRISPR, Knock-Out, In Vitro

( a ) Schematic view of B4galt1 functional test in tumor microenvironment. ( b ) CRISPR/Cas9 knockout of B4galt1 in OT-I T-cells enhances growth control of B16F10-OVA tumors in vivo. The p-value was calculated using two-way ANOVA. ( c ) Compared with control OT-I T-cells, the tumors were significantly smaller when B4galt1 knockout OT-I T-cells were transplanted (n=5 for control, n=7 for sgB4galt1). The p-value was calculated using a two-tailed Student’s t -test. ( d ) CRISPR/Cas9 knockout of B4galt1 increases numbers of OT-I T-cells in B16F10-OVA tumors (n=5 for control, n=7 for sgB4galt1). The p-value was calculated using a two-tailed Student’s t -test. The in vivo functional effects were biologically replicated at least twice. Data are shown as the mean ± SEM. *p<0.05; **p<0.01.

Journal: eLife

Article Title: Ex vivo and in vivo CRISPR/Cas9 screenings identify the roles of protein N-glycosylation in regulating T-cell activation and functions

doi: 10.7554/eLife.108724

Figure Lengend Snippet: ( a ) Schematic view of B4galt1 functional test in tumor microenvironment. ( b ) CRISPR/Cas9 knockout of B4galt1 in OT-I T-cells enhances growth control of B16F10-OVA tumors in vivo. The p-value was calculated using two-way ANOVA. ( c ) Compared with control OT-I T-cells, the tumors were significantly smaller when B4galt1 knockout OT-I T-cells were transplanted (n=5 for control, n=7 for sgB4galt1). The p-value was calculated using a two-tailed Student’s t -test. ( d ) CRISPR/Cas9 knockout of B4galt1 increases numbers of OT-I T-cells in B16F10-OVA tumors (n=5 for control, n=7 for sgB4galt1). The p-value was calculated using a two-tailed Student’s t -test. The in vivo functional effects were biologically replicated at least twice. Data are shown as the mean ± SEM. *p<0.05; **p<0.01.

Article Snippet: A whole-genome CRISPR knockout gRNA library (1000000096) was purchased from Addgene.

Techniques: Functional Assay, CRISPR, Knock-Out, Control, In Vivo, Two Tailed Test

Validation of CD70 as a GB target for CAR-T cell therapy (A) Expression of CD70 and selected markers from an in-house glioma patient single-cell RNA seq dataset. (B) CD70 expression in GB samples from Heidelberg University Hospital, analyzed by bulk RNAseq. Each dot represents a patient. A Mann-Whitney test was performed to assess statistical significance. (C) CD70 expression in 20 matched pairs from (B). A two-tailed paired t test was used to assess significance. (D) IHC staining of three Heidelberg University Hospital GB patients from (B) with high CD70 expression based on RNAseq. Scale bars, 200 μm. Patient-1 and Patient-3: primary GB; Patient-2: recurrent GB. (E) Measurement of CD70 protein levels on GB cells by flow cytometry. (F) Measurement of CD70 gene expression levels in glioma cell lines by RT-qPCR. N = 3 technical replicates per cell line. (G) Correlation between CD70 gene expression and protein levels from (E) and (F). (H) Measurement of CD70 on the surface of generated primary GB models by flow cytometry (blue histograms). An isotype control antibody (red histograms) was used. For (E) and (H), data were gated on single live cells. Data presented as mean (SD). ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, ∗∗∗∗ p < 0.0001; n.s., not significant.

Journal: Molecular Therapy Oncology

Article Title: A comparative analysis of CD70-directed CAR-T cells for glioblastoma treatment demonstrates a superior efficacy of the ligand-based construct

doi: 10.1016/j.omton.2026.201134

Figure Lengend Snippet: Validation of CD70 as a GB target for CAR-T cell therapy (A) Expression of CD70 and selected markers from an in-house glioma patient single-cell RNA seq dataset. (B) CD70 expression in GB samples from Heidelberg University Hospital, analyzed by bulk RNAseq. Each dot represents a patient. A Mann-Whitney test was performed to assess statistical significance. (C) CD70 expression in 20 matched pairs from (B). A two-tailed paired t test was used to assess significance. (D) IHC staining of three Heidelberg University Hospital GB patients from (B) with high CD70 expression based on RNAseq. Scale bars, 200 μm. Patient-1 and Patient-3: primary GB; Patient-2: recurrent GB. (E) Measurement of CD70 protein levels on GB cells by flow cytometry. (F) Measurement of CD70 gene expression levels in glioma cell lines by RT-qPCR. N = 3 technical replicates per cell line. (G) Correlation between CD70 gene expression and protein levels from (E) and (F). (H) Measurement of CD70 on the surface of generated primary GB models by flow cytometry (blue histograms). An isotype control antibody (red histograms) was used. For (E) and (H), data were gated on single live cells. Data presented as mean (SD). ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, ∗∗∗∗ p < 0.0001; n.s., not significant.

Article Snippet: For cloning of the lentiviral CD70 knockout construct, the LentiCRISPRv2GFP was a gift from David Feldser (Addgene #82416; http://n2t.net/addgene:82416 ; RRID:Addgene_82416).

Techniques: Biomarker Discovery, Expressing, Single Cell, RNA Sequencing, RNA sequencing, MANN-WHITNEY, Two Tailed Test, Immunohistochemistry, Flow Cytometry, Gene Expression, Quantitative RT-PCR, Generated, Control

Generation and phenotyping of anti-CD70 CAR-Tcells (A) CAR construct design. (B) Transduction efficiency of primary human T cells by flow cytometry. A non-transduced (NT) sample from each donor was used to determine gating. Data gated on single live CD3 + cells. (C) CD8a/CD4 expression on transduced T cells, determined by flow cytometry. A one-way ANOVA followed by a Dunnett’s multiple comparisons test was performed to assess significance. (D) Expression of exhaustion receptors on transduced T cells, determined by flow cytometry. (E) Quantification of PD1 + /LAG3 + /TIM3 + T cells from (D). (F) Expression of immune memory-associated markers on transduced T cells by flow cytometry. For (C), (D), (E), and (F), N = 3 biological replicates per group. Isotype controls were used to determine gating and displayed data are gated on single live CD3 + cells (NT) or single live CD3 + /tdTomato + cells (SFG, CD27z, LF28z, and LFBBz). Data presented as mean (SD). A one-way ANOVA followed by a post-hoc Šídák’s multiple comparisons test was performed. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, ∗∗∗∗ p < 0.0001; n.s., not significant.

Journal: Molecular Therapy Oncology

Article Title: A comparative analysis of CD70-directed CAR-T cells for glioblastoma treatment demonstrates a superior efficacy of the ligand-based construct

doi: 10.1016/j.omton.2026.201134

Figure Lengend Snippet: Generation and phenotyping of anti-CD70 CAR-Tcells (A) CAR construct design. (B) Transduction efficiency of primary human T cells by flow cytometry. A non-transduced (NT) sample from each donor was used to determine gating. Data gated on single live CD3 + cells. (C) CD8a/CD4 expression on transduced T cells, determined by flow cytometry. A one-way ANOVA followed by a Dunnett’s multiple comparisons test was performed to assess significance. (D) Expression of exhaustion receptors on transduced T cells, determined by flow cytometry. (E) Quantification of PD1 + /LAG3 + /TIM3 + T cells from (D). (F) Expression of immune memory-associated markers on transduced T cells by flow cytometry. For (C), (D), (E), and (F), N = 3 biological replicates per group. Isotype controls were used to determine gating and displayed data are gated on single live CD3 + cells (NT) or single live CD3 + /tdTomato + cells (SFG, CD27z, LF28z, and LFBBz). Data presented as mean (SD). A one-way ANOVA followed by a post-hoc Šídák’s multiple comparisons test was performed. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, ∗∗∗∗ p < 0.0001; n.s., not significant.

Article Snippet: For cloning of the lentiviral CD70 knockout construct, the LentiCRISPRv2GFP was a gift from David Feldser (Addgene #82416; http://n2t.net/addgene:82416 ; RRID:Addgene_82416).

Techniques: Construct, Transduction, Flow Cytometry, Expressing

In vitro assessment of the CD70-directed CAR-T cell anti-GB cytotoxicity (A) Measurement of secreted TNF-α and IFN-γ in the SN of GB/CAR-T cell co-cultures by ELISA. N = 3 biological replicates per group. For comparison between MCS and CD70 (upper bar plots), an unpaired two-tailed t test was used. For comparisons among constructs (bottom), a one-way ANOVA followed by a Holm-Šídák multiple comparisons test was used. (B) Measurement of tumor cell signal during co-culture with CAR-T cells on the Incucyte platform. N = 2 biological replicates per group. Every biological replicate is the mean of N = 5 technical replicates. Time point intervals = 45 min. A two-tailed Student’s t test was performed using the values of the last measured time point to determine statistical significance. For (A) and (B), data presented as mean (SD). ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, ∗∗∗∗ p < 0.0001; n.s., not significant.

Journal: Molecular Therapy Oncology

Article Title: A comparative analysis of CD70-directed CAR-T cells for glioblastoma treatment demonstrates a superior efficacy of the ligand-based construct

doi: 10.1016/j.omton.2026.201134

Figure Lengend Snippet: In vitro assessment of the CD70-directed CAR-T cell anti-GB cytotoxicity (A) Measurement of secreted TNF-α and IFN-γ in the SN of GB/CAR-T cell co-cultures by ELISA. N = 3 biological replicates per group. For comparison between MCS and CD70 (upper bar plots), an unpaired two-tailed t test was used. For comparisons among constructs (bottom), a one-way ANOVA followed by a Holm-Šídák multiple comparisons test was used. (B) Measurement of tumor cell signal during co-culture with CAR-T cells on the Incucyte platform. N = 2 biological replicates per group. Every biological replicate is the mean of N = 5 technical replicates. Time point intervals = 45 min. A two-tailed Student’s t test was performed using the values of the last measured time point to determine statistical significance. For (A) and (B), data presented as mean (SD). ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, ∗∗∗∗ p < 0.0001; n.s., not significant.

Article Snippet: For cloning of the lentiviral CD70 knockout construct, the LentiCRISPRv2GFP was a gift from David Feldser (Addgene #82416; http://n2t.net/addgene:82416 ; RRID:Addgene_82416).

Techniques: In Vitro, Enzyme-linked Immunosorbent Assay, Comparison, Two Tailed Test, Construct, Co-Culture Assay

Assessment of anti-CD70 CAR-T cell killing in naturally CD70 expressing cell lines (A) CD70 expression levels (blue histogram) on primary GB cell line MMKI by flow cytometry. Data gated on single live cells. An isotype control (red histogram) was used. (B) Quantification of activation marker CD137 after O/N co-culture of MMKI cells with CD70-targeting CAR-T cells by flow cytometry. N = 4 biological replicates per group. Data gated on single live CD3 + cells (NT) or single live CD3 + /tdTomato + cells (SFG, CD27z, LF28z, and LFBBz). Isotype control antibodies were used for gating. A one-way ANOVA followed by a Tukey’s multiple comparisons test was applied for significance. (C) Measurement of CD70 (blue histograms) on the surface of generated genetic knockout models by flow cytometry. An isotype control (red histogram) was used. Data gated on single live EGFP + cells. (D) Measurement of tumor cell signal during co-culture with CAR-T cells on the Incucyte platform. N = 2 biological replicates per group. Every biological replicate is the mean of N = 5 technical replicates. Time point intervals = 45 min. Statistical significance was assessed as in B). For (B) and (D), data are presented as mean (SD). ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, ∗∗∗∗ p < 0.0001; n.s., not significant.

Journal: Molecular Therapy Oncology

Article Title: A comparative analysis of CD70-directed CAR-T cells for glioblastoma treatment demonstrates a superior efficacy of the ligand-based construct

doi: 10.1016/j.omton.2026.201134

Figure Lengend Snippet: Assessment of anti-CD70 CAR-T cell killing in naturally CD70 expressing cell lines (A) CD70 expression levels (blue histogram) on primary GB cell line MMKI by flow cytometry. Data gated on single live cells. An isotype control (red histogram) was used. (B) Quantification of activation marker CD137 after O/N co-culture of MMKI cells with CD70-targeting CAR-T cells by flow cytometry. N = 4 biological replicates per group. Data gated on single live CD3 + cells (NT) or single live CD3 + /tdTomato + cells (SFG, CD27z, LF28z, and LFBBz). Isotype control antibodies were used for gating. A one-way ANOVA followed by a Tukey’s multiple comparisons test was applied for significance. (C) Measurement of CD70 (blue histograms) on the surface of generated genetic knockout models by flow cytometry. An isotype control (red histogram) was used. Data gated on single live EGFP + cells. (D) Measurement of tumor cell signal during co-culture with CAR-T cells on the Incucyte platform. N = 2 biological replicates per group. Every biological replicate is the mean of N = 5 technical replicates. Time point intervals = 45 min. Statistical significance was assessed as in B). For (B) and (D), data are presented as mean (SD). ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, ∗∗∗∗ p < 0.0001; n.s., not significant.

Article Snippet: For cloning of the lentiviral CD70 knockout construct, the LentiCRISPRv2GFP was a gift from David Feldser (Addgene #82416; http://n2t.net/addgene:82416 ; RRID:Addgene_82416).

Techniques: Expressing, Flow Cytometry, Control, Activation Assay, Marker, Co-Culture Assay, Generated, Knock-Out

Evaluation of CD70-directed CAR-T cell effector function in cerebral organoids (A) Confocal microscopy of cerebral organoids, infiltrated by generated GB models. (B) Quantification of CD70 signal in organoids from (A). Each dot represents an organoid. A Welch’s t test was used to assess significance. (C) Immunofluorescence analysis of endogenous CD70 expression in cerebral organoids. (D) Confocal microscopy of cerebral organoids previously invaded by GB cells and subsequently treated with CAR-T cells for 3 d. (E) Quantification of Granzyme-B signal from (D). A two-tailed t test was used to determine significance. (F) Measurement of secreted Granzyme-B and IFN-γ levels in the SN of co-cultures from (D) by ELISA. N = 3 biological replicates per group. (G) CAR construct direct comparisons from (F). A one-way ANOVA followed by a Tukey’s post hoc test for multiple comparisons was used. For (A), (C), and (D), scale bars, 200 μm. For (D) and (E), N ≥ 3 organoids per group. For (E) and (F), a two-tailed t test was used to assess significance. For (B), (E), and (F), data presented as mean (SD). ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, ∗∗∗∗ p < 0.0001; n.s., not significant.

Journal: Molecular Therapy Oncology

Article Title: A comparative analysis of CD70-directed CAR-T cells for glioblastoma treatment demonstrates a superior efficacy of the ligand-based construct

doi: 10.1016/j.omton.2026.201134

Figure Lengend Snippet: Evaluation of CD70-directed CAR-T cell effector function in cerebral organoids (A) Confocal microscopy of cerebral organoids, infiltrated by generated GB models. (B) Quantification of CD70 signal in organoids from (A). Each dot represents an organoid. A Welch’s t test was used to assess significance. (C) Immunofluorescence analysis of endogenous CD70 expression in cerebral organoids. (D) Confocal microscopy of cerebral organoids previously invaded by GB cells and subsequently treated with CAR-T cells for 3 d. (E) Quantification of Granzyme-B signal from (D). A two-tailed t test was used to determine significance. (F) Measurement of secreted Granzyme-B and IFN-γ levels in the SN of co-cultures from (D) by ELISA. N = 3 biological replicates per group. (G) CAR construct direct comparisons from (F). A one-way ANOVA followed by a Tukey’s post hoc test for multiple comparisons was used. For (A), (C), and (D), scale bars, 200 μm. For (D) and (E), N ≥ 3 organoids per group. For (E) and (F), a two-tailed t test was used to assess significance. For (B), (E), and (F), data presented as mean (SD). ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, ∗∗∗∗ p < 0.0001; n.s., not significant.

Article Snippet: For cloning of the lentiviral CD70 knockout construct, the LentiCRISPRv2GFP was a gift from David Feldser (Addgene #82416; http://n2t.net/addgene:82416 ; RRID:Addgene_82416).

Techniques: Confocal Microscopy, Generated, Immunofluorescence, Expressing, Two Tailed Test, Enzyme-linked Immunosorbent Assay, Construct

In vivo evaluation of the anti-CD70 CAR-T cell killing efficacy (A) In vivo pipeline. (B) Measurement of tumor cell signal in mice orthotopically implanted with P3/CD70_NLuc/EGFP cells and subsequently treated ICT with anti-CD70 CAR-T cells by BLI. (C) Quantification of BLI signals from B). N = 8 animals per group. (D) Overall survival of treated mice from B). The log rank (Mantel-Cox) test was used to assess statistical significance. Bonferroni-adjusted significance threshold: p = 0.0083. (E) Analysis of CAR-T cell persistence and CD70 expression in recurrent tumors of treated mice from (A) by IF. Representative images from N = 3 animals per group. Scale bars, 100 μm.

Journal: Molecular Therapy Oncology

Article Title: A comparative analysis of CD70-directed CAR-T cells for glioblastoma treatment demonstrates a superior efficacy of the ligand-based construct

doi: 10.1016/j.omton.2026.201134

Figure Lengend Snippet: In vivo evaluation of the anti-CD70 CAR-T cell killing efficacy (A) In vivo pipeline. (B) Measurement of tumor cell signal in mice orthotopically implanted with P3/CD70_NLuc/EGFP cells and subsequently treated ICT with anti-CD70 CAR-T cells by BLI. (C) Quantification of BLI signals from B). N = 8 animals per group. (D) Overall survival of treated mice from B). The log rank (Mantel-Cox) test was used to assess statistical significance. Bonferroni-adjusted significance threshold: p = 0.0083. (E) Analysis of CAR-T cell persistence and CD70 expression in recurrent tumors of treated mice from (A) by IF. Representative images from N = 3 animals per group. Scale bars, 100 μm.

Article Snippet: For cloning of the lentiviral CD70 knockout construct, the LentiCRISPRv2GFP was a gift from David Feldser (Addgene #82416; http://n2t.net/addgene:82416 ; RRID:Addgene_82416).

Techniques: In Vivo, Expressing

mCD27-based anti-murine CD70 CAR-T cells are potent against murine GB in vitro (A) Murine CD27-based construct design. (B) Transduction efficiency of primary murine T cells by flow cytometry. A non-transduced (NT) sample from each donor mouse was used to determine gating. Data gated on single live mCD3 + cells. (C) Measurement of mCD70 gene expression levels in generated OE models by RT-qPCR. N = 3 technical replicates per cell line. (D) Measurement of mCD70 on the surface of generated murine OE GB models by flow cytometry (blue histograms). Signal was compared to that of an isotype control (red histograms). (E) Quantification of secreted TNF-α in the SN of mGB/mCAR-T cell co-cultures by ELISA. N = 3 biological replicates per group. (F) Pairwise comparisons of secreted TNF-α levels from (E) among targeting constructs. A one-way ANOVA with a post hoc Holm-Šídák test was used for significance. (G) Schematic representation of the live-cell imaging pipeline. (H) Quantification of tumor cell signal from (G) over time. A one-way ANOVA with a Dunnett’s multiple comparisons test was used with data from the t = 660 min mark. For (C) and (E), an unpaired two-tailed t test was used for significance. Data are presented as mean (SD). ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, ∗∗∗∗ p < 0.0001; n.s., not significant; n.d., not detected.

Journal: Molecular Therapy Oncology

Article Title: A comparative analysis of CD70-directed CAR-T cells for glioblastoma treatment demonstrates a superior efficacy of the ligand-based construct

doi: 10.1016/j.omton.2026.201134

Figure Lengend Snippet: mCD27-based anti-murine CD70 CAR-T cells are potent against murine GB in vitro (A) Murine CD27-based construct design. (B) Transduction efficiency of primary murine T cells by flow cytometry. A non-transduced (NT) sample from each donor mouse was used to determine gating. Data gated on single live mCD3 + cells. (C) Measurement of mCD70 gene expression levels in generated OE models by RT-qPCR. N = 3 technical replicates per cell line. (D) Measurement of mCD70 on the surface of generated murine OE GB models by flow cytometry (blue histograms). Signal was compared to that of an isotype control (red histograms). (E) Quantification of secreted TNF-α in the SN of mGB/mCAR-T cell co-cultures by ELISA. N = 3 biological replicates per group. (F) Pairwise comparisons of secreted TNF-α levels from (E) among targeting constructs. A one-way ANOVA with a post hoc Holm-Šídák test was used for significance. (G) Schematic representation of the live-cell imaging pipeline. (H) Quantification of tumor cell signal from (G) over time. A one-way ANOVA with a Dunnett’s multiple comparisons test was used with data from the t = 660 min mark. For (C) and (E), an unpaired two-tailed t test was used for significance. Data are presented as mean (SD). ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, ∗∗∗∗ p < 0.0001; n.s., not significant; n.d., not detected.

Article Snippet: For cloning of the lentiviral CD70 knockout construct, the LentiCRISPRv2GFP was a gift from David Feldser (Addgene #82416; http://n2t.net/addgene:82416 ; RRID:Addgene_82416).

Techniques: In Vitro, Construct, Transduction, Flow Cytometry, Gene Expression, Generated, Quantitative RT-PCR, Control, Enzyme-linked Immunosorbent Assay, Live Cell Imaging, Two Tailed Test

mCD27-based CAR constructs lead to regression of syngeneic GB tumors in vivo (A) Schematic representation of the syngeneic model in vivo experiment. (B) Evaluation of mCAR expression on transduced murine T cells on treatment day by flow cytometry. A non-transduced sample was used to determine gating. Data gated on single live mCD3 + cells. (C) Weekly tumor volume evaluation in C57BL/6J mice orthotopically implanted with GL261/CD70 cells and subsequently treated ICT with anti-mCD70 CAR-T cells by MRI. A one-way ANOVA with a Dunnett’s multiple comparisons test was used to assess significance. (D) Indicative T2-weighed MRI sections (coronal plane) from N = 3 mice of each treatment group from (C), before and after treatment with anti-mCD70 CAR-T cells. (E) Comparison of tumor volumes among treatment groups from (C). For day-14, a one-way ANOVA followed by a Tukey’s multiple comparisons test was used. For day-21, a Welch’s ANOVA followed by a Dunnett’s T3 multiple comparisons test was used. For day-28, a Kruskal-Wallis test followed by a Dunn’s multiple comparisons test was used. Data presented as mean (SD). (F) Overall survival of treated mice from (C). The log rank (Mantel-Cox) test was used to assess statistical significance. Bonferroni-adjusted significance threshold: p = 0.0166. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, ∗∗∗∗ p < 0.0001; n.s., not significant; n.d., not detected.

Journal: Molecular Therapy Oncology

Article Title: A comparative analysis of CD70-directed CAR-T cells for glioblastoma treatment demonstrates a superior efficacy of the ligand-based construct

doi: 10.1016/j.omton.2026.201134

Figure Lengend Snippet: mCD27-based CAR constructs lead to regression of syngeneic GB tumors in vivo (A) Schematic representation of the syngeneic model in vivo experiment. (B) Evaluation of mCAR expression on transduced murine T cells on treatment day by flow cytometry. A non-transduced sample was used to determine gating. Data gated on single live mCD3 + cells. (C) Weekly tumor volume evaluation in C57BL/6J mice orthotopically implanted with GL261/CD70 cells and subsequently treated ICT with anti-mCD70 CAR-T cells by MRI. A one-way ANOVA with a Dunnett’s multiple comparisons test was used to assess significance. (D) Indicative T2-weighed MRI sections (coronal plane) from N = 3 mice of each treatment group from (C), before and after treatment with anti-mCD70 CAR-T cells. (E) Comparison of tumor volumes among treatment groups from (C). For day-14, a one-way ANOVA followed by a Tukey’s multiple comparisons test was used. For day-21, a Welch’s ANOVA followed by a Dunnett’s T3 multiple comparisons test was used. For day-28, a Kruskal-Wallis test followed by a Dunn’s multiple comparisons test was used. Data presented as mean (SD). (F) Overall survival of treated mice from (C). The log rank (Mantel-Cox) test was used to assess statistical significance. Bonferroni-adjusted significance threshold: p = 0.0166. ∗ p < 0.05, ∗∗ p < 0.01, ∗∗∗ p < 0.001, ∗∗∗∗ p < 0.0001; n.s., not significant; n.d., not detected.

Article Snippet: For cloning of the lentiviral CD70 knockout construct, the LentiCRISPRv2GFP was a gift from David Feldser (Addgene #82416; http://n2t.net/addgene:82416 ; RRID:Addgene_82416).

Techniques: Construct, In Vivo, Expressing, Flow Cytometry, Comparison

a , Western blots of HEK293T cells and of Cx43 and Cx43/Cx45 knockout cell lines generated with CRISPR-Cas9. Vinculin was used as a loading control. b , Representative normalized fluorescence traces of two visually connected Cx43/Cx45 KO cells stably expressing rEstus2s. c , Linear correlation of the time traces from b with superimposed linear fit (bold line). d , r values from linear correlations of rEstus2s for Cx43 KO, Cx43/Cx45 KO, and Cx43/Cx45 KO with stable overexpression of Cx43. Black rhombs are means. e, f , Superimposed normalized fluorescence traces of 50 Cx43 KO cells each with rEstus2s, or Cx43/Cx45 KO cells with rEstus2s either alone or with additional overexpression of Cx43, ANO1, or K Ca 3.1. Cells were either individual (e) or in a confluent layer (f). g , Peak-to-peak excursions of relative rEstus2s fluorescence in individual and confluent cells. The number of analyzed cells is indicated in parentheses.

Journal: bioRxiv

Article Title: Sub-Millivolt Voltage Imaging Reveals Gap Junction-Mediated Bioelectric Contact Inhibition

doi: 10.64898/2026.02.10.701308

Figure Lengend Snippet: a , Western blots of HEK293T cells and of Cx43 and Cx43/Cx45 knockout cell lines generated with CRISPR-Cas9. Vinculin was used as a loading control. b , Representative normalized fluorescence traces of two visually connected Cx43/Cx45 KO cells stably expressing rEstus2s. c , Linear correlation of the time traces from b with superimposed linear fit (bold line). d , r values from linear correlations of rEstus2s for Cx43 KO, Cx43/Cx45 KO, and Cx43/Cx45 KO with stable overexpression of Cx43. Black rhombs are means. e, f , Superimposed normalized fluorescence traces of 50 Cx43 KO cells each with rEstus2s, or Cx43/Cx45 KO cells with rEstus2s either alone or with additional overexpression of Cx43, ANO1, or K Ca 3.1. Cells were either individual (e) or in a confluent layer (f). g , Peak-to-peak excursions of relative rEstus2s fluorescence in individual and confluent cells. The number of analyzed cells is indicated in parentheses.

Article Snippet: The following guide RNAs (gRNAs) from the human CRISPR knockout pooled library A (GeCKOv2) were cloned into the lentiCRISPRv2 (Addgene #52961): GJA1 (Cx43): 19135: TCAGCGCACCACTGGTCGCA, 19136: TGTGTTCTATGTGATGCGAA GJC1 (Cx45): 19177: CATCTTCCCGAATCCGTCGT, 19179: GCAAGCCCTATGCAATGCGC HEK293T cells were transiently transfected with the lentiCRISPRv2 expression plasmids using Roti®-fect.

Techniques: Western Blot, Knock-Out, Generated, CRISPR, Control, Fluorescence, Stable Transfection, Expressing, Over Expression

Comparison of the steady-state protein levels of wild-type Parkin and R42P in (A) wild-type cells (WT n = 9.7×10 3 , R42P n = 1×10 4 ) and BAG6 knockout cells (WT n = 1×10 4 , R42P n = 1×10 4 ) and (B) wild-type cells (WT n = 9×10 3 , R42P n = 9×10 3 ) and RNF126 knockout cells (WT n = 9×10 3 , R42P n = 9×10 3 ). (C) Treatment with 10 µM bortezomib (BZ) for 16 hours in BAG6 knockout cells (R42P n = 9.5×10 3 ) and (D) RNF126 knockout cells (R42P n = 9×10 3 ). Controls from panels (A) and (B) are included for comparison. (E) Treatment with 1 µM TAK243 for 16 hours in BAG6 knockout cells (R42P n = 1.1×10 4 ) and (F) RNF126 knockout cells (R42P n = 9×10 3 ). Controls from panels (A) and (B) are included for comparison.

Journal: bioRxiv

Article Title: BAG6 and RNF126 are broadly involved in protein quality control of non-native missense protein variants

doi: 10.64898/2026.02.04.703735

Figure Lengend Snippet: Comparison of the steady-state protein levels of wild-type Parkin and R42P in (A) wild-type cells (WT n = 9.7×10 3 , R42P n = 1×10 4 ) and BAG6 knockout cells (WT n = 1×10 4 , R42P n = 1×10 4 ) and (B) wild-type cells (WT n = 9×10 3 , R42P n = 9×10 3 ) and RNF126 knockout cells (WT n = 9×10 3 , R42P n = 9×10 3 ). (C) Treatment with 10 µM bortezomib (BZ) for 16 hours in BAG6 knockout cells (R42P n = 9.5×10 3 ) and (D) RNF126 knockout cells (R42P n = 9×10 3 ). Controls from panels (A) and (B) are included for comparison. (E) Treatment with 1 µM TAK243 for 16 hours in BAG6 knockout cells (R42P n = 1.1×10 4 ) and (F) RNF126 knockout cells (R42P n = 9×10 3 ). Controls from panels (A) and (B) are included for comparison.

Article Snippet: The BAG6 CRISPR/Cas9 knockout plasmid (sc-432477, Santa Cruz), BAG6 HDR plasmid (sc-432477-HDR, Santa Cruz Biotechnology), and Cre Vector (sc-418923, Santa Cruz Biotechnology) were used to generate HEK293T TetBxb1BPFiCasp9 BAG6 knockout cells.

Techniques: Comparison, Knock-Out

Comparison of the flow cytometry profiles of the site saturated Parkin variant library expressed in wild-type cells (n = 1×10 6 ) and (A) BAG6 knockout cells (n = 1×10 6 ) and (B) RNF126 knockout cells (n = 1×10 6 ). (C) As panel (A) including the gating scheme used for flow sorting.

Journal: bioRxiv

Article Title: BAG6 and RNF126 are broadly involved in protein quality control of non-native missense protein variants

doi: 10.64898/2026.02.04.703735

Figure Lengend Snippet: Comparison of the flow cytometry profiles of the site saturated Parkin variant library expressed in wild-type cells (n = 1×10 6 ) and (A) BAG6 knockout cells (n = 1×10 6 ) and (B) RNF126 knockout cells (n = 1×10 6 ). (C) As panel (A) including the gating scheme used for flow sorting.

Techniques: Comparison, Flow Cytometry, Variant Assay, Knock-Out

(A) Heatmap of the Parkin variant abundance scores determined previously by VAMP-seq . The nonsense variants, marked with an asterisk (*) and median abundance scores (mdn) per position for missense variants are shown above the heat-map. The abundance scores range from low (red) over WT-like (white) to increased abundance (blue). Missing variants are marked in grey, and the wild-type residues are shown in yellow. The Parkin domain organization is indicated with colored bars. (B) Heatmap showing the Parkin variants abundance change in BAG6 knockout cells. The colors display the ΔPSI, with blue variants being stabilized. (C) Comparison of the PSIs in wild-type (Crtl) cells and BAG6 knockout cells. Low abundance variants were defined as variants with a control PSI < 1.5 and colored blue or grey according to ΔPSI. High abundance variants (control PSI ≥ 1.5), termed above gate are marked in black (above the FACS gate). (D) Comparison of the Parkin variant abundance in wild-type cells as determined before (x-axis) and the ΔPSIs in the BAG6 knockout cells determined here. The new VAMP-seq experiment was designed with focus on low abundance variants, while the previous data also resolved the high abundance variants. (E) The AlphaFold2 predicted full-length Parkin structure (AF-O60260-F1) colored by the median (mdn) ΔPSI as in panel B. Note that the BAG6-responsive positions (blue) are buried.

Journal: bioRxiv

Article Title: BAG6 and RNF126 are broadly involved in protein quality control of non-native missense protein variants

doi: 10.64898/2026.02.04.703735

Figure Lengend Snippet: (A) Heatmap of the Parkin variant abundance scores determined previously by VAMP-seq . The nonsense variants, marked with an asterisk (*) and median abundance scores (mdn) per position for missense variants are shown above the heat-map. The abundance scores range from low (red) over WT-like (white) to increased abundance (blue). Missing variants are marked in grey, and the wild-type residues are shown in yellow. The Parkin domain organization is indicated with colored bars. (B) Heatmap showing the Parkin variants abundance change in BAG6 knockout cells. The colors display the ΔPSI, with blue variants being stabilized. (C) Comparison of the PSIs in wild-type (Crtl) cells and BAG6 knockout cells. Low abundance variants were defined as variants with a control PSI < 1.5 and colored blue or grey according to ΔPSI. High abundance variants (control PSI ≥ 1.5), termed above gate are marked in black (above the FACS gate). (D) Comparison of the Parkin variant abundance in wild-type cells as determined before (x-axis) and the ΔPSIs in the BAG6 knockout cells determined here. The new VAMP-seq experiment was designed with focus on low abundance variants, while the previous data also resolved the high abundance variants. (E) The AlphaFold2 predicted full-length Parkin structure (AF-O60260-F1) colored by the median (mdn) ΔPSI as in panel B. Note that the BAG6-responsive positions (blue) are buried.

Techniques: Variant Assay, Knock-Out, Comparison, Control

(A) Comparison of the steady-state protein levels of wild-type (WT) PAH, PAH I65T, PAH L348V, FLCN, FLCN H255P and R239C variants in wild-type and BAG6 knockout cells. (B) Comparison of the steady-state protein levels of wild-type (WT) PAH, PAH I65T, PAH L348V, FLCN, FLCN H255P and R239C variants in wild-type and RNF126 knockout cells. N = 10 4 cells for all experiments.

Journal: bioRxiv

Article Title: BAG6 and RNF126 are broadly involved in protein quality control of non-native missense protein variants

doi: 10.64898/2026.02.04.703735

Figure Lengend Snippet: (A) Comparison of the steady-state protein levels of wild-type (WT) PAH, PAH I65T, PAH L348V, FLCN, FLCN H255P and R239C variants in wild-type and BAG6 knockout cells. (B) Comparison of the steady-state protein levels of wild-type (WT) PAH, PAH I65T, PAH L348V, FLCN, FLCN H255P and R239C variants in wild-type and RNF126 knockout cells. N = 10 4 cells for all experiments.

Techniques: Comparison, Knock-Out

Mutations leading to a partial (or full) unfolding of the native structure render the protein a target for BAG6 and RNF126-mediated ubiquitin-dependent proteasomal degradation. Conversely, HSP90 and STIP1 stabilize the native state, while TSC1 and TSC2 inhibit HSP90. Created in BioRender. Hartmann-Petersen, R. (2025) https://BioRender.com/sly8ce1 .

Journal: bioRxiv

Article Title: BAG6 and RNF126 are broadly involved in protein quality control of non-native missense protein variants

doi: 10.64898/2026.02.04.703735

Figure Lengend Snippet: Mutations leading to a partial (or full) unfolding of the native structure render the protein a target for BAG6 and RNF126-mediated ubiquitin-dependent proteasomal degradation. Conversely, HSP90 and STIP1 stabilize the native state, while TSC1 and TSC2 inhibit HSP90. Created in BioRender. Hartmann-Petersen, R. (2025) https://BioRender.com/sly8ce1 .

Techniques: Ubiquitin Proteomics

Review

cgas crispr cas9 knockout cgas crispr cas9 plasmid (Santa Cruz Biotechnology)

Structured Review

Images

Related Articles

CRISPR:

Knock-Out:

Generated:

Cotransfection:

Transfection:

Control:

Clone Assay:

Similar Products

Image Search Results